MIENTRAS TANTO

La principal

Añadido por ACV | Comentar(79)
Imágenes, Carteles y Desmotivaciones de

carteles mientras tanto plaza catalua barcelona cafe senoras porras acv mayo policia sacar pepa desmotivaciones

bueno
1200
malo
64
facebook twitter


Los mejores comentarios


u.s
u.s    
     +2 / 0  
jajajaja, que buenoo!
la inocencia de una persona mayor...xD

mediometro
mediometro    
     +2 / 0  
jajajaja joer xDD tiene su gracia!! jajaaj k makina estás hecho +1

Comentarios (79)


pertur
pertur    
     +1 / -1  
resubido espero que esta vez te den mas positivos xD

ACV
ACV    
     0 / 0  
@pertur, si! me había votado negativo un troll, estaba votando negativos todos los carteles!
gracias :)

usohorario
usohorario    
     0 / 0  
@ACV, quizas te voto negativo porque este estaba en cr

u.s
u.s    
     +2 / 0  
jajajaja, que buenoo!
la inocencia de una persona mayor...xD

ACV
ACV    
     0 / 0  
@u.s, ya ves, los hay muy inocentes si :D
gracias!!

rocknrolla
rocknrolla    
     +1 / 0  
jajajajaj muy bueno

ACV
ACV    
     0 / 0  
@rocknrolla, muchas gracias :D

jank
jank    
     +1 / 0  
jajajajajjajaj genial +1

ACV
ACV    
     0 / 0  
@jank, gracias jank :P

alex23
alex23    
     +1 / 0  
me has matado xDDD
jajaja

ACV
ACV    
     0 / 0  
@alex23, jajaja me alegro que te guste!!
gracias!

er_xarvi
er_xarvi    
     +2 / 0  
jajaja muy bueno!
con la de porras que sacaron habria que pedirse otro café

ACV
ACV    
     0 / 0  
@er_xarvi, y palomitas...!
gracias :D

esekinodrn
esekinodrn    
     +1 / 0  
Hehehehe Di una pequeña carcajada Cuando lo lei xD
Muy Bueno +1 Y Favoritos

ACV
ACV    
     0 / 0  
@esekinodrn, jajaja me alegro que así sea :) queria darle un toque de humor a semejante penosidad
gracias!

salinero14
salinero14    
     +1 / 0  
Jajaja muy buenos, dry

ACV
ACV    
     +1 / 0  
@salinero14, muchas gracias salinero!! :D

salinero14
salinero14    
     +1 / 0  
@ACV, No hay de qué ^_^

sesevillano
sesevillano    
     +1 / 0  
jaajajaj que triste xD a ver si sacan algo :S

ACV
ACV    
     0 / 0  
@sesevillano, esperemos!! gracias :)

ACV
ACV    
     0 / 0  
@ferminelfiero, gracias Fermín!

FuLL-
FuLL-    
     +1 / 0  
Vaya... jajaja

ACV
ACV    
     0 / 0  
@FuLL-, :D gracias!!

edu_vrs
edu_vrs    
     +1 / 0  
jajajaja muy bueno ;)

ACV
ACV    
     0 / 0  
@edu_vrs, jajaj gracias :D

Hidan23
Hidan23    
     +1 / 0  
jajajajajajajaja genial XD

ACV
ACV    
     0 / 0  
@Hidan23, gracias Adri!! :P

Kessler
Kessler    
     +1 / 0  
un poco cruel pero gracioso xD

ACV
ACV    
     0 / 0  
@Kessler, si bueno, quería buscar algo gracioso de semejante penosidad, espero que no sea mal tomado!

mediometro
mediometro    
     +2 / 0  
jajajaja joer xDD tiene su gracia!! jajaaj k makina estás hecho +1

ACV
ACV    
     0 / 0  
@mediometro, muchas gracias :D se agradece

namreg
namreg    
     +1 / 0  
jaajajajajaj muy bueno^^

ACV
ACV    
     0 / 0  
@namreg, jajajj gracias!! :P

JaviiEr18
JaviiEr18    
     +1 / 0  
jajajajajaja en plan cine xD

ACV
ACV    
     0 / 0  
@JaviiEr18, si si, les falta pedir unas palomitas o algo xDD
gracias :)

bono vertigo
bono vertigo    
     +1 / 0  
XDD +1

ACV
ACV    
     0 / 0  
@bono vertigo, :D gracias!

bono vertigo
bono vertigo    
     +1 / 0  
@ACV, De nada!! =)

oli_arbiol
oli_arbiol    
     +1 / 0  
jajajajajajajajajajaja hacen apuesta disiendo que es lo proximo que va suceder xDD

ACV
ACV    
     0 / 0  
@oli_arbiol, jajajaja lo dicho, palomitas y a apostar si xD
gracias :)

Ikorsch
Ikorsch    
     +1 / 0  
jajajajajaa
xD

ACV
ACV    
     0 / 0  
@Ikorsch, gracias Ikorsch :D

yosu-antitodo
yosu-antitodo    
     +1 / 0  
Jajajaja geniaal! xD

ACV
ACV    
     0 / 0  
@yosu-antitodo, muchas gracias! :)

f10
f10    
     +1 / 0  
jajajjajaja

ACV
ACV    
     0 / 0  
@f10, gracias :D

GoldenGirl
GoldenGirl    
     +1 / 0  
LOOOOOOOOOOOOOOOOOL, buenísimo, el primer cartel que le da un toque de humor a todo esto ;).

ACV
ACV    
     0 / 0  
@GoldenGirl, sin ofender a nadie, era mi intención¡ gracias :)

er_xarvi
er_xarvi    
     +1 / 0  
felicidades por la principal!

vesi
vesi    
     0 / 0  
LOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOL xD

musemingo
musemingo    
     +1 / 0  
JAJAJAJJAA QUE BUENO! +1
No le heches un ojo0 a mis carteles! ;)

Arthurooo9
Arthurooo9    
     +1 / 0  
Felicidades...
+1

Leurzz
Leurzz    
     +1 / 0  
Felicidades! ^^

embaucadores
embaucadores    
     0 / 0  
esto es de

rcNgl
rcNgl    
     +1 / 0  
felicidadesssss

.Headbanger.
.Headbanger.    
     +1 / 0  
congratulations ACV!!

Ender2
Ender2    
     +1 / 0  
Que pidan porras con chocolate para amenizar.
Esta juventud... ehm... esta inocente gente mayor.

Rugbybull55
Rugbybull55    
     +1 / 0  
jajajaja

cosmefs
cosmefs    
     +1 / 0  
que pidan porras y que al traerlas digan:
-NO QUEREMOS ESTAS, QUEREMOS LAS DE LA CALLE Y QUE ACABE LA VIOLENCIA DE UNA VEZ-

pompero
pompero    
     +1 / 0  
felicidades por la principal aceuve :)

Theress88
Theress88    
     +1 / 0  
bueno, no vi el futuro exacto con la otra imagen pero algo te tenian que subir xDDD
felicidadeees!!

mediometro
mediometro    
     +1 / 0  
otra principal?? eres un abusón!! ajajjaajja FELICIDADES muak!!

vallekas5
vallekas5    
     +1 / 0  
vef...

cargar
cargar    
     +1 / 0  
jajajjjaaa muy bueno, +1 y enhorabuena por la principal: que razon tienes, se convierte en rutina

adrionly95
adrionly95    
     +1 / 0  
JAAJAJAJAJAJAajajajajjajaja

ke_lo_ke
ke_lo_ke    
     +1 / 0  
fg n

emiliogd
emiliogd    
     +1 / 0  
jajajajaja típico de las abuelas xD
felicidades por la principal :D

Damadenoche
Damadenoche    
     +1 / 0  
jajajaj genial !

Mr.huevos
Mr.huevos    
     +1 / 0  
¡Felicidades por la princi, tío! :DD

desmotivado 15
desmotivado 15    
     +1 / 0  
XDDDDDDD

SR.XDD!
SR.XDD!    
     0 / 0  
matadame a negativos!!! NO ENTIENDO EL CARTEL BUGFAGUAGUAUGAUGAUUAGAUGUA IM STUIDT! :d

adri_quiere_venganza
adri_quiere_venganza    
     +1 / 0  
@SR.XDD!, Ya que no esta adri te lo explico yo. las senoras estan en el bar y dice una :ya sacan las porras pero de los policias para dar a los manifestamtes y la otra cree que son poreas de comer por eso lo del cafe entendiste no hay razon para votarre negativo ACV es un tio muy majo fijo que lo entiende

SR.XDD!
SR.XDD!    
     0 / 0  
@adri_quiere_venganza, vote negativo?? esque tanta manifestación...

SR.XDD!
SR.XDD!    
     0 / 0  
@adri_quiere_venganza, =mente, yo soy mas dechurros que de porrras

adri_quiere_venganza
adri_quiere_venganza    
     0 / 0  
@SR.XDD!, pues yo tambien soy mas de churross y de donuts!! XD

SR.XDD!
SR.XDD!    
     0 / 0  
@adri_quiere_venganza, os es logico que no lo pillase! pero claro...a una porra policial no la llaman churro.Normalmente, le van otro significado no muy bonito

adri_quiere_venganza
adri_quiere_venganza    
     +1 / -1  
Adri fiera!!!! Eres el amo de desmotivaciones enorabuena por tu nosecuantas principales XD me tenes q ensenar a hacer esos caryeles tan buenos :)

esekinodrn
esekinodrn    
     +1 / 0  
Sabia Que iva a la Proncipal Tio Enhorabuena!!!!!!!
Esque este t lo as currao ehh xD

.TimeRemiT14.
.TimeRemiT14.    
     0 / 0  
JAJJAJAJAJ



Iniciar sesión, para comentar tienes que registrarte.


LOS MEJORES CARTELES DE

Número de visitas: 10591998881 | Usuarios registrados: 2033491 | Clasificación de usuarios
Carteles en la página: 7956523, hoy: 61, ayer: 104
blog.desmotivaciones.es
Contacto | Reglas
▲▲▲

Valid HTML 5 Valid CSS!