Llorar desconsoladamente

La principal

Añadido por Vmarkina | Comentar(285)
Imágenes, Carteles y Desmotivaciones de

carteles llorar vmarkina desmotivacioneses desmotivaciones

bueno
2154
malo
15
facebook twitter


Los mejores comentarios


SlipKnotH
SlipKnotH    
     +16 / 0  
@Zislo, No siempre tiene por qué ser de él/ella. A mi las palabras más dolorosas que he escuchado es cuando me dijeron ''Lo siento, pero no hemos podido salvarla'' se referían a mi madre, han pasado 2 meses y mi padre aún cuando va a visitarla al cementerio llora.

Chukitazo
Chukitazo    
     +8 / 0  
No sé porque asociáis esto al amor, a mi la pérdida de una persona importante me afecta muchísimo más que la de una persona que tiene el más mínimo interés en ti. Dicha noticia me llegó hace unos 23 días "Christian, ya abuela ya ha muerto". El impacto es impresionante y porque no hablar del torbellino de emociones posterior. Pasas día a día pensando en esa persona, en saber que no vas a sentir su piel, no vas a ver su sonrisa... Así que para mí es totalmente incomparable el dolor que se sufre con el amor y el dolor que se sufre con la muerte, porque este ultimo te desgarra el alma...

Comentarios (285)


sinllegar
sinllegar    
     +1 / 0  
Por fin te pillo por la cola

Vmarkina
Vmarkina    
     0 / 0  
@sinllegar, Enhorabuena e.e

sinllegar
sinllegar    
     0 / 0  
@Vmarkina, :D ahora puede votarte negativo

Zislo
Zislo    
     +2 / 0  
Y a veces no deberíamos llorar por ello, porque quien te lo dice no merece una sola lágrima tuya... Pero así es la realidad :( +1

Vmarkina
Vmarkina    
     +1 / 0  
@Zislo, Pero a veces, sí que merece esas lágrimas...

Zislo
Zislo    
     0 / 0  
@Vmarkina, Lose...

SlipKnotH
SlipKnotH    
     +16 / 0  
@Zislo, No siempre tiene por qué ser de él/ella. A mi las palabras más dolorosas que he escuchado es cuando me dijeron ''Lo siento, pero no hemos podido salvarla'' se referían a mi madre, han pasado 2 meses y mi padre aún cuando va a visitarla al cementerio llora.

schizophreniaxy
schizophreniaxy    
     0 / 0  
@SlipKnotH, Lo siento amigo....si necesitas aun desconocido, tienes uno aqui n.n

horchata_racing
horchata_racing    
     0 / 0  
@SlipKnotH, lo siento

miguel352
miguel352    
     0 / 0  
@SlipKnotH, lo siento mucho compañero

0 KindeR
0 KindeR    
     0 / 0  
Pillado^^

Vmarkina
Vmarkina    
     0 / 0  
@0 KindeR, :)

0 KindeR
0 KindeR    
     0 / 0  
@Vmarkina, (:

Robersinho
Robersinho    
     0 / 0  
Uffff!
¡+1!

Vmarkina
Vmarkina    
     0 / 0  
@Robersinho, Thx

adita ñañañaña
adita ñañañaña    
     0 / 0  
:'/

Vmarkina
Vmarkina    
     0 / 0  
mediometro
mediometro    
     0 / 0  
:( que triste...

Vmarkina
Vmarkina    
     0 / 0  
@mediometro, Es lo que hay

Lordbep
Lordbep    
     0 / 0  
Muy buen cartel Victor... algo triste, pero muy bueno al fin y al cabo

Vmarkina
Vmarkina    
     0 / 0  
@Lordbep, Gracias...Bueno, es triste, pero esto ocurre :S

12Wanns
12Wanns    
     +2 / 0  
y llorar dias y dias sabiendo que costará cambiar..

Vmarkina
Vmarkina    
     +1 / 0  
@12Wanns, :(

12Wanns
12Wanns    
     0 / 0  
@Vmarkina, enfin.. no se lo que te pasará, pero animo:)

Vmarkina
Vmarkina    
     +1 / 0  
@12Wanns, Bueh, todo pasa, de una forma u otra.

12Wanns
12Wanns    
     0 / 0  
@Vmarkina, bueno.. pero mientras tanto:)

salinero14
salinero14    
     0 / 0  
No me gusta este cartel....

Vmarkina
Vmarkina    
     +2 / 0  
@salinero14, Menos me gusta a mí...

nereaSAB97
nereaSAB97    
     0 / 0  
:O!
Muy bueno ^^

Vmarkina
Vmarkina    
     0 / 0  
@nereaSAB97, Gracias

flipy89
flipy89    
     0 / 0  
una gran putada! :S

Vmarkina
Vmarkina    
     +2 / 0  
@flipy89, Como tantas que hay.

flipy89
flipy89    
     0 / 0  
@Vmarkina, si la verdad :/

anonima_15
anonima_15    
     +1 / 0  
Y, a veces, intentar esconderlas sin conseguirlo... :S

Vmarkina
Vmarkina    
     0 / 0  
@anonima_15, Esconderlas es una chorrada...

charles lee ray
charles lee ray    
     0 / 0  
es muy duro, te come la impotencia

Vmarkina
Vmarkina    
     0 / 0  
@charles lee ray, Te comen tantas cosas...

Aerith
Aerith    
     0 / 0  
Ufff esoo si qe es realmente duroooo T.T

Vmarkina
Vmarkina    
     0 / 0  
@Aerith, :(

Babysotha
Babysotha    
     0 / 0  
Nadie merece tus lágrimas y quien las merece nunca te hará llorar :)

Vmarkina
Vmarkina    
     +3 / 0  
@Babysotha, Eso es mentira.

Aerith
Aerith    
     0 / 0  
@Babysotha, Eso no es del todo cierto... porque puedes llorar por cientoos de cosas como la muerte de un familiar y el si merece tus lagrimas por todo lo que ha dado por ti o a lo mejor un novio o novia que por lo que sea se tiene que alejar de ti no puedes evitar llorar y ese entonces no merece tus lagrimas ?

Babysotha
Babysotha    
     0 / 0  
@Vmarkina, Es un refrán. Y yo creo que nadie las merece y quien las merece pocas veces te hará llorar.

Babysotha
Babysotha    
     0 / 0  
@Aerith, Yo no he dicho que la muerte de un familiar no las merezca ;) Porque yo he llorado más delo que tú te piensas.
NOVIOS TENDRÁS MUCHOS HASTA QUE ENCUENTRES EL VERDADERO ;)
Yo con ese refrán me refería al tema del amor, no de la muerte de un familiar ni etc.

Babysotha
Babysotha    
     +1 / 0  
@Babysotha, Y si te tienes que alejar ahi si las merece, me refiero aaaal que te hace llorar por que te trata mal o algo -.-

Aerith
Aerith    
     0 / 0  
@Babysotha, Ya ya me imagine pero aunque novios tengamos muchos... no quita que su marcha a otro pais o sitio por problemas familiares te haga derramar lágrimas no ?? y esas lágrimas no las merece ? después de TODAS las cosas buenas que pasaron ?

Aerith
Aerith    
     0 / 0  
@Babysotha, Si ese no las merece pero no todas las lagrimas derramadas son porque te trato mal o no ?? ^^

Vmarkina
Vmarkina    
     0 / 0  
@Babysotha, Bueno, pues es que a mí nadie me ha tratado mal.

Babysotha
Babysotha    
     0 / 0  
@Aerith, YO EN NINGÚN MOMENTO HE DICHO QUE NO LAS MEREZCA. ME REFERÍA AL TEMA DEL AMOR, DE LOS NIÑOS O NIÑAS QUE TE HACEN LLORAR PORQUE TE HAN DEJADO O ALGO, CUANDO SABRÁS QUE ERES JOVEN Y HABRÁ MÁS, ME REFERÍA A ESE TEMA, NO AL DE LA MARCHA DE ALGUIEN.

Vmarkina
Vmarkina    
     0 / -1  
@Babysotha, Pero qué fácil es decir las cosas, joder. Nano, si se te va alguien que ha hecho por ti, que habéis estado bien, por circunstancias ajenas a la voluntad, no las merece, pues? Pues habrán más, quizás, pero quién sabe si igual...

Aerith
Aerith    
     0 / 0  
@Babysotha, Aiish que ya lo se pero que no te pongas asi que lei el otro comentario tuyo despues de responder a esee jolineees...

Babysotha
Babysotha    
     0 / 0  
@Aerith, No quería que sonara mal (:
@Vmarkina, No habrá nadie igual porque cada persona es un mundo distinto. Me parece bien si no te han tratado mal, algún día te tendrá que pasar.
Y TE REPITO QUE ME REFERÍA A CUANDO ALGUIEN TE TRATA MAL, NO CUANDO ALGUIEN SE VA, POR CIRCUSTANCIAS O QUE -.- ME REFERÍA EN EL TEMA ESE DEL AMOR QUE TE TRATAN MAL -.-.

Vmarkina
Vmarkina    
     0 / 0  
@Babysotha, Vale, me ha quedado claro -.-

Babysotha
Babysotha    
     0 / 0  
@Vmarkina, Perdón si no ha sonado bien como lo he dicho.

Vmarkina
Vmarkina    
     0 / 0  
@Babysotha, No pasa nada.

Aerith
Aerith    
     0 / 0  
@Babysotha, No pasa nada no te preocupeees ^^

MotivadoAVivir
MotivadoAVivir    
     0 / 0  
Hermoso cartel! me recordo muchos momentos no agradables, pero que a fin de cuentas me enseñaron mucho...la vida sigue, uno por ahi se topa con personas que no son las que aparentan ser, te llenan de suesños y iluciones para luego robarte ese paquete armado asi nomas...
se sigue que se le va hacer...+1 y Fv.! saludos!

Vmarkina
Vmarkina    
     0 / 0  
@MotivadoAVivir, Hay gente para todo, muchas gracias^^

SuperMariaBatinera
SuperMariaBatinera    
     0 / 0  
@Vmarkina, Yo creo que el refrán se refiere, a que si tu novio se va a otro país , el no querrá que llores,es casi lo mismo que no te hará llorar, que no le dará igual, por eso el hará todo lo posible para que no llores, es eso :D

Vmarkina
Vmarkina    
     0 / 0  
@SuperMariaBatinera, pero que haga todo lo posible no lo hace evitable :S

SuperMariaBatinera
SuperMariaBatinera    
     0 / 0  
@Vmarkina, Lo sé, pero por lo menos a el no le dará igual que llores o no, hará lo imposible por no hacerte daño

Vmarkina
Vmarkina    
     +1 / 0  
@SuperMariaBatinera, Pero eso no quiere decir que lo consiga, las intenciones no garantizan resultados, jamás.

SuperMariaBatinera
SuperMariaBatinera    
     0 / 0  
@Vmarkina, Ya, pero por más que lo intente, todo el mundo tiene defectos, si no le fallas hoy, le fallarás mañana quieras o no, pero a esa persona si de verdad te importa, harás lo menos posible para hacerle daño, pero tu no puedes sufrir por su felicidad porque te verá triste y entonces ella también se pondrá triste

shabyarin
shabyarin    
     +2 / -1  
Hijo...... hay algo que quiero decirte. no te preocupes no se trata sobre que mate a tu perro al meter el auto ni que la abuela se cayo y se raspo las rodillas, mucho menos de que tu hermana perdio la virginidad....¬¬ si como no, "perderla la virgidad" la muy calenturienta bien que sabe donde la dejo, pero en fin estoy divagando, lo que queria decirte tampoco tiene que ver con que tire tus juguetes ni con que vendi tu lap para comprar un TV mas grande, lo que quiero decir es mucho mas importante. Hijo.............. Tu........¡¡¡¡ TU EQUIPO FAVORITO PERDIO 5-0!!!!
hIJO.-Ñooooooooooooooooooooooo

shabyarin
shabyarin    
     0 / -1  
¿Quieren monologo?

Vmarkina
Vmarkina    
     0 / 0  
@shabyarin, Estás loco...xD

shabyarin
shabyarin    
     0 / -1  
@Vmarkina, jejejjejejeej en fin creo que entendiste mi punto que justo ahorita me voy a inventar pero como ando corto de imaginacion ahorita voy a dejarlo asi

Vmarkina
Vmarkina    
     0 / 0  
@shabyarin, Déjalo así ._.

martukiih
martukiih    
     0 / 0  
Que triste :(
Me identifico mucho..me lo quedo!

Vmarkina
Vmarkina    
     0 / 0  
@martukiih, Llévatelo, que no vuelva :S

martukiih
martukiih    
     0 / 0  
@Vmarkina, Tranquilo no volverá! ;)

lorenita23
lorenita23    
     +2 / 0  
Digo lo mismo que "mi" chochete, no me gusta nada este cartel... :S

Vmarkina
Vmarkina    
     +1 / 0  
@lorenita23, Bueno, hay muchas cosas en este mundo que no nos gustan...

lorenita23
lorenita23    
     +1 / 0  
@Vmarkina, Ya me imagino, ya..

Pebbles
Pebbles    
     0 / 0  
Llorar ..............No lloro....

Vmarkina
Vmarkina    
     0 / 0  
@Pebbles, ¿?

Pebbles
Pebbles    
     0 / 0  
@Vmarkina, Yo no lloro por eso.....

Vmarkina
Vmarkina    
     0 / 0  
@Pebbles, ¿Llorar por recibir duras palabras? Lo vería extraño no hacerlo :S

Pebbles
Pebbles    
     0 / 0  
@Vmarkina, Estoy acostumbrado tuve una vida dura.....Fuera de mi casa....

Vmarkina
Vmarkina    
     0 / 0  
@Pebbles, Uno nunca se acostumbra al dolor, Pebbles

Pebbles
Pebbles    
     0 / 0  
@Vmarkina, Entonces no has sufrido lo suficiente....

Vmarkina
Vmarkina    
     0 / 0  
@Pebbles, Eso es lo que uno dice para protegerse, mientras se destroza por dentro.

Pebbles
Pebbles    
     0 / 0  
@Vmarkina, Quien te ha dicho eso no todos somos lo mismo....

Vmarkina
Vmarkina    
     0 / 0  
@Pebbles, Pebbles, tengo 19 años, tú no pisas ni los 27. Lo que nos queda por vivir, de dureza, ya es mucho. Puede que a ti más, no se sabe, pero nadie es inmune al dolor y al sufrimiento.

Pebbles
Pebbles    
     0 / 0  
@Vmarkina, Voy a cumplir 26 he sufrido mucho y POR QUE YO quise no sabes la vida dura que he llevado ni te lo podrias imaginar... no dije que soy inmune al dolor pero por lo que dice el cartel ni siquiera me inmuto...

SlipKnotH
SlipKnotH    
     +1 / 0  
@Pebbles, No te hagas el chulo xD, a mi por regla general las cosas no me afectan lo mas mínimo, me gusta una chica y ella no quiere estar conmigo? fácil, me queda vida, paso de ella, existen más. Pero hay cosas que no se pueden evitar, cuando mi madre murió vi como se me venía el mundo encima, ¿cómo se esquiva eso? No se puede..

Pebbles
Pebbles    
     0 / 0  
@SlipKnotH, Estoy diciendo que no lloraria por lo que dice el cartel ..........................................................no que no lloraria por cosas que realmente valgan la pena.........

Vmarkina
Vmarkina    
     0 / 0  
@Pebbles, El cartel en sí no es el que te haría llorar, es de cajón, simplemente emula la experiencia que podemos haber tenido todos, y que lo siento, pero no me creo que no hayas tenido, o que al menos, vayas a tener alguna vez en tu vida.

Pebbles
Pebbles    
     0 / 0  
@Vmarkina, Lo que dice el cartel es que llorarias desconsoladamente mientras escuchas las palabras mas dolorosas que hubieras oido yo he escuchado mas de mil si se puede decir en muy poco tiempo .......Hasta que simplemente las ignoras y no hacen nada mas que ser un susurro en el viento........

Vmarkina
Vmarkina    
     0 / 0  
@Pebbles, Si puedes ignorarlas, no serán palabras tan duras, sin más.

p_aula
p_aula    
     +1 / -1  
Demasiadas lágrimas malgastadas en cosas sin importancia... y cuando ocurre algo verdaderamente doloroso, puede que no te queden lágrimas que llorar.

Vmarkina
Vmarkina    
     0 / 0  
@p_aula, Creo que ya no me quedan, aunque quién sabe...

RobyWan
RobyWan    
     0 / 0  
joder tio :( tendremos que hablar

Vmarkina
Vmarkina    
     0 / 0  
@RobyWan, He podido hacer ahora una conexión espontánea, pero ando sin ordenador estos días, pero en cuanto pueda, hablamos :)

RobyWan
RobyWan    
     0 / 0  
@Vmarkina, ya veo...

LadyBathory
LadyBathory    
     0 / 0  
dudo que hayas oído las palabras mas duras de tu vida... las hay peores...

Vmarkina
Vmarkina    
     0 / 0  
@LadyBathory, Las palabras no son duras en sí, lo son por el momento, por la persona, por el impacto, y por muchas cosas más. Cosas que tienen que ver con mi vida y desconoces, así que decir eso es hablar un tanto...desde la ignorancia. Total, hablo de MI vida, así que lo sabré mejor que nadie, no?

LadyBathory
LadyBathory    
     +3 / -2  
@Vmarkina, no dudo que en ese momento fueran duras, dolorosas y desgarradoras, pero las peores palabras que puede oir alguien son un no hemos podido salvarle, ha luchado pero no ha resistido o su padre, madre, hermano, hermana o hijo o hija ha muerto.. te lo puedo asegurar, una vez oyes esas palabras.. las demas parecen azucar.

Lerstons
Lerstons    
     +1 / -2  
@LadyBathory, A veces el dolor por amor es peor que el dolor por la muerte.

Vmarkina
Vmarkina    
     0 / 0  
@LadyBathory, Todo depende de cada uno, así lo creo yo. Sé de muertes cercanas que me dolerían menos que otras cosas.

Vmarkina
Vmarkina    
     0 / 0  
@Lerstons, A veces...

LadyBathory
LadyBathory    
     0 / 0  
@Vmarkina, @Lerstons, Obviamente V, yo he tenido muertes cercanas que ni me he inmutado de ellas, pero no se trata de eso, yo he perdido a personas, que por sangre no teniamos lazo, pero si por el amor que nos teniamos, y el hecho de saber que más nunca iba a compartir con esas personas una carcajada me mató el alma, sufrir por amor es doloroso, no lo niego, pero por que siempre esperamos, creamos espectativas que en ocasiones no se cumple, y es el fracaso lo que duele, pero yo que he podido experimentar ambas situaciones, puedo asegurar, que no hay nada más jodido que ver a un amigo, pariente

LadyBathory
LadyBathory    
     0 / 0  
@LadyBathory, primo, hermano o padre y madre luchar por su vida, que la muerte le gane la partida y tener que oir un no pudimos hacer nada para salvarlo, o lucho pero no lo logro. Cuando alguien muere por que así lo decide es diferente a cuando alguien se aferra a la vida y cae...

Vmarkina
Vmarkina    
     0 / 0  
@LadyBathory, Bueno, no digo que no sea más duro, hasta que no lo sufra no podré hablar, pero perder a una persona para siempre en vida, o en muerte, puede ser igual de doloroso, creo yo.

LadyBathory
LadyBathory    
     +1 / 0  
@Vmarkina, Es que para mi perder a alguien es algo fisico, es decir, alguien me pertenece? yo creo que no, por lo tanto no perdemos a nadie, simplemente son personas que pasan por nuestra vida, cuando esa persona muere perdemos su compañia, sus risas, sus muecas, es irremediable, pero cuando alguien se aleja siempre tenemos opcion de poder seguir disfrutando de ciertos momentos... no se...

Vmarkina
Vmarkina    
     0 / 0  
@LadyBathory, ¿Opciones? La esperanza se acaba, y personas que se fueron sabes que jamás volverán, nada de ellas. Hasta nunca.

LadyBathory
LadyBathory    
     0 / 0  
@Vmarkina, No hable de la esperanza, pero siempre puedes seguir teniendo ciertos momentos con las personas que aun estan vivas que con las muertas, asi se alejen de tu vida, hoy dia puedes hacer todo lo que quieras sin necesidad de traspasar la barrera de lo ilegal...

Vmarkina
Vmarkina    
     0 / 0  
@LadyBathory, Hay cosas que en vida, se pierden para siempre. Y aun encima te queda la sensación de creer posible tenerlo, y luego no tenerlo jamás.

LadyBathory
LadyBathory    
     0 / 0  
@Vmarkina, eso es por que el ser humano siempre espera pero no acepta o le cuesta aceptar.

Vmarkina
Vmarkina    
     0 / 0  
@LadyBathory, Joder, y tanto que cuesta aceptar...

LadyBathory
LadyBathory    
     0 / 0  
@Vmarkina, me estas dando la razón? o.O

Vmarkina
Vmarkina    
     0 / 0  
@LadyBathory, Sí, por? xD

LadyBathory
LadyBathory    
     +1 / 0  
@Vmarkina, me da miedo... :S

Vmarkina
Vmarkina    
     0 / 0  
@LadyBathory, No debería u.u

LadyBathory
LadyBathory    
     0 / 0  
@Vmarkina, Y por que no debería?

Vmarkina
Vmarkina    
     0 / 0  
@LadyBathory, Porque nos parecemos mucho.

LadyBathory
LadyBathory    
     0 / 0  
@Vmarkina, eso es lo que mas miedo da -.-

Vmarkina
Vmarkina    
     0 / 0  
@LadyBathory, No debería darte miedo

LadyBathory
LadyBathory    
     +5 / 0  
@Vmarkina, acojona tener más en común con alguien que no has visto y sólo hablas por internet que con la gente de tu entorno

Lerstons
Lerstons    
     +1 / 0  
@LadyBathory, +10000000000000000000000000000000 a eso

Vmarkina
Vmarkina    
     0 / 0  
@LadyBathory, Bueno, yo creo que no es algo tan raro. Encontrar afinidad en el entorno es jodido..

LadyBathory
LadyBathory    
     0 / 0  
@Vmarkina, para mi hasta hace un tiempo no lo era =(

Vmarkina
Vmarkina    
     0 / 0  
@LadyBathory, Bueno, todo llega :)

LadyBathory
LadyBathory    
     0 / 0  
@Vmarkina, o no... no me preocupa... xd

Lerstons
Lerstons    
     0 / 0  
Tío, aunque no lo creas, te comprendo, es decir.. tengo hasta un cartel con esas palabras T_T
Si necesitas algo, lo que sea, no dudes nunca en hablar conmigo. Te ayudaré en todo lo que pueda y un poco más :)

Vmarkina
Vmarkina    
     0 / 0  
@Lerstons, No soy único, ni especial, muchos habrán pasado ya por lo que paso yo. Pero como todos, pues todo pasa, todo se supera, y se pasa página, y ya está ^^
No te preocupes por mí :)

Lerstons
Lerstons    
     0 / 0  
@Vmarkina, El ego no es bueno V

Lerstons
Lerstons    
     0 / 0  
@Lerstons, No es ego, me he equivocado, sería "autismo"

Vmarkina
Vmarkina    
     0 / 0  
@Lerstons, Yo soy el único que puede superar mis problemas, vencer a mis sentimientos, y nadie más.

Lerstons
Lerstons    
     0 / 0  
@Vmarkina, Tú verás tío, mientras te recuperes...

Vmarkina
Vmarkina    
     0 / 0  
@Lerstons, Claro que me recuperaré, coño, que la vida sigue xD

Lerstons
Lerstons    
     0 / 0  
@Vmarkina, Para ti sigue, para mi no..

Vmarkina
Vmarkina    
     0 / 0  
@Lerstons, Para todos sigue, para TODOS.

Bulma272
Bulma272    
     0 / 0  
Lo he sentido.. y nunca me había sentido tan sola como esa vez.. :S

Vmarkina
Vmarkina    
     +1 / 0  
@Bulma272, Es jodidamente horrible...

alex23
alex23    
     0 / 0  
y mientras las recuerdas...
muy bueno, aunque me ha hecho recordar malos momentos

Vmarkina
Vmarkina    
     0 / 0  
@alex23, El momento de más impacto es el momento en que las escuchas...
Gracias^^

juan97
juan97    
     0 / 0  
Felicidades Maquina

Vmarkina
Vmarkina    
     0 / 0  
@juan97, Gracias!

lorenita23
lorenita23    
     0 / 0  
Joder.. no se si felicitarte o que por la principal..
es muy triste, coño! :'(

Vmarkina
Vmarkina    
     0 / 0  
@lorenita23, No sé yo si alegrarme de que haya llegado...

schizophreniaxy
schizophreniaxy    
     0 / 0  
Sergio está muerto, no lo verás jamas imbecil
Aun me acuerdo
+1 :DDD

Vmarkina
Vmarkina    
     0 / 0  
@schizophreniaxy, Tus palabras son las que más me han impactado de todas las escritas en los comentarios de este cartel. No me preguntes por qué, no lo sé, pero así ha sido :S
Gracias

schizophreniaxy
schizophreniaxy    
     0 / 0  
@Vmarkina, No se como tomarmelo, fue un acontecimiento muy duro, pero supongo que la gente se sorprende es bueno, dando así a pensar que e podido pasar por algo malo y seguir a delande.
Me gusta mucho tu carte =)
PD: A los que han tenido mala suerte en su vida por así decirlo" Hay que animarse! =)

Vmarkina
Vmarkina    
     0 / 0  
@schizophreniaxy, Dices lo mismo que he dicho en mi comentario de abajo.

schizophreniaxy
schizophreniaxy    
     0 / 0  
@Vmarkina, LOL! Perdona ni siquiera lo lei! no me tomes por un plagiador >-

eceballos
eceballos    
     0 / 0  
Llorar, en ocaciones es necesario!!

Vmarkina
Vmarkina    
     0 / 0  
@eceballos, Pero es jodidamente doloroso :S

04_Venus_24
04_Venus_24    
     0 / 0  
A mi nunca me las han dicho, & espero qe tampoco lo hagan !! :(:(

Vmarkina
Vmarkina    
     0 / 0  
@04_Venus_24, Llegarán, tranquil@ que llegarán...

Conecta2.dk
Conecta2.dk    
     0 / 0  
felicidades y mismcondolencias (?)

Vmarkina
Vmarkina    
     0 / 0  
@Conecta2.dk, Gracias y...gracias? No son condolencias lo que debes darme.

MonsterRawwr
MonsterRawwr    
     0 / 0  
Muy buen cartel. Y omg ~ Sin negativos!

Vmarkina
Vmarkina    
     0 / 0  
@MonsterRawwr, Gracias!

NuRiaaSoloTu
NuRiaaSoloTu    
     +1 / 0  
Llorar mientras recuerdas esas palabras que te dice tu amiga y sabes que es verdad.
~No te quería solo te utilizo~
Y notar que las lágrimas caen una tras otra por que es cierto...

Vmarkina
Vmarkina    
     0 / 0  
@NuRiaaSoloTu, Es duro, duro...

Brp_flink
Brp_flink    
     0 / 0  
me hiciste recordar muchas cosas :'( muy bueno +1

Vmarkina
Vmarkina    
     0 / 0  
@Brp_flink, Recuerdos, odiosos recuerdos.
Gracias!

isamia
isamia    
     0 / 0  
ufffff :(:(:( a favoritos y felicidades por la principal!

Vmarkina
Vmarkina    
     0 / 0  
@isamia, Muchas gracias, isa

fuckyujawainot
fuckyujawainot    
     +2 / 0  
''ha muerto, murió anoche'' :'(

Laia215
Laia215    
     +2 / 0  
@fuckyujawainot, esas palabras son muy duras... :(

fuckyujawainot
fuckyujawainot    
     0 / 0  
@Laia215, muy muy duras u.u

Vmarkina
Vmarkina    
     +1 / 0  
@fuckyujawainot, Deu meu, vais a deprimirme u.u

fuckyujawainot
fuckyujawainot    
     0 / 0  
@Vmarkina, a mi si que me desmotivo cuando me lo dijeron u.u

flipy89
flipy89    
     0 / 0  
felicidades por la prin ^^

Vmarkina
Vmarkina    
     +1 / 0  
@flipy89, Gracias^^

flipy89
flipy89    
     0 / 0  
@Vmarkina, de nada!

dimeloaloido
dimeloaloido    
     0 / 0  
pero haber, asociais esas palabras con el amor por lo que veo.. y no solo es eso, por ejemplo las palabras mas duras que e escuchado yo son: tu prima lucia a muerto. y no todo es amor. ME ALEGRO POR LA PRINICPAL, ENHORABUENA, TE LO MERECES:D +1

Vmarkina
Vmarkina    
     0 / 0  
@dimeloaloido, La gente lo ha asociado más con la muerte que con el amor. Y va para ambas cosas, y todas las que sean duras en esta vida :S

Aerith
Aerith    
     0 / 0  
Al final llegaste a la princiii GENIAAAL
muchas felicidadees ^^

emiliogd
emiliogd    
     0 / 0  
lo siento, usted es eréctil

slake
slake    
     0 / 0  
Penoso :(

slake
slake    
     +1 / 0  
@slake, No en sentido de que sea malo, sino que da mucha pena.
Principal merecida V :)

Vmarkina
Vmarkina    
     0 / 0  
@slake, Gracias, slake

loschinosnomiransospechan
loschinosnomiransospechan    
     0 / 0  
justamente ayer me paso eso =(

Vmarkina
Vmarkina    
     0 / 0  
@loschinosnomiransospechan, Bueno, todo pasa :)

loveee (L)
loveee (L)    
     0 / 0  
Muy buen cartel. Me encanta!
a mi me paso eso hace poco, y todo se supera, poco a poco pero se supera :)

victorkamu
victorkamu    
     0 / 0  
@loveee (L), si es verdad, pero asta que se supera...

loveee (L)
loveee (L)    
     0 / 0  
@victorkamu, Pues si, aunque mientras no lo superes te toca sufrir

Cristina Jm
Cristina Jm    
     0 / 0  
es verdad

victorkamu
victorkamu    
     0 / 0  
Yo llore desconsoladamente con: - Yo no te quiero

loveee (L)
loveee (L)    
     0 / 0  
@victorkamu, te dijeron eso?

ACV
ACV    
     0 / 0  
de las peores situaciones..
felicidades V :)

sm89
sm89    
     0 / 0  
Aunque sea tan triste y no me guste nada... felicidades V

MariahhDesMott
MariahhDesMott    
     0 / 0  
Felicidades por laprincipal... :) +1
Y el cartel... estoy viviendo eso... y es lo peor...

doncarlos212
doncarlos212    
     0 / 0  
lo siento pero no me gustas, de eso aun no me he recuperado.

albita_love
albita_love    
     0 / 0  
Me encanta!^^

Varpa
Varpa    
     +1 / 0  
Si, y si esas palabras viene de tu padre y sean "siempre me estas defraudando, nunca conseguiré quererte" cuando lo único que intento es hacerlo lo mejor posible u.u

Amy Lee (8)
Amy Lee (8)    
     0 / 0  
Para mí: No te quiero (del chico que me gusta) o Tu padre se muere de cáncer (mi familia).

noelia_rz
noelia_rz    
     0 / 0  
Cierto.
Pero lo mío no es una palabra, si no un imagen. La de ver a tu padre llorar por tu culpa, eso si que es doloroso.

schizophreniaxy
schizophreniaxy    
     +1 / 0  
Amigos desmotivadores que estan desmotivados , hay que animarse cojones!! los carteles se comparten en lo bueno y en lo malo , y aqui somos un grupo de gente, anoanima ,pero que nunca estamos solos, debeis tener eso en cuenta =)

Lerelerele
Lerelerele    
     +4 / 0  
"Tu no eres mi hermana, me das asco", "cuando llegue a casa no te quiero ver más aqui, coje la maleta y vete", "tu perro tiene cancer y hay que sacrificarlo", etc.

Lerelerele
Lerelerele    
     +3 / 0  
@Lerelerele, PD: Todo esto con 14 años

fuckyujawainot
fuckyujawainot    
     +1 / 0  
@Lerelerele, ''fuiste un accidente'' ''no te murieras'' etc e.e

andrixnightmare
andrixnightmare    
     0 / 0  
las ultimas palabras mas duras k oi fueron:The Rev ha muerto.... T_T

epicfail12
epicfail12    
     0 / 0  
Este cartel sería más apropiado para un a chica, no?
Felicidades por la principal

epicfail12
epicfail12    
     0 / 0  
@epicfail12, una*

martukiih
martukiih    
     +1 / 0  
Felicidades V, se merece la principal! ^^

Vmarkina
Vmarkina    
     0 / 0  
@martukiih, Gracias! Pues no tengo claro si quería que llegara, la verdad...

laura_isla
laura_isla    
     0 / 0  
Felicidades por la princi V, y espero que ya andes mejor :)

Vmarkina
Vmarkina    
     0 / 0  
@laura_isla, Muchas gracias! y sí, ando mejor ^^

chemachantada
chemachantada    
     0 / 0  
waaa que gran cartel +1 y favoritos

Vmarkina
Vmarkina    
     0 / 0  
@chemachantada, Gracias :)

chemachantada
chemachantada    
     0 / 0  
@Vmarkina, de nada ;) ta muy bien este cartel =D la principal la tiene bien merecida

Vmarkina
Vmarkina    
     0 / 0  
@chemachantada, Merecida o no, yo no quería que llegase...

chemachantada
chemachantada    
     0 / 0  
@Vmarkina, y eso?

Vmarkina
Vmarkina    
     0 / 0  
@chemachantada, Porque tengo mucho mejores carteles que éste, y porque de todas las lindezas que subo, me tienen que subir lo más triste de mi perfil, joder :S

chemachantada
chemachantada    
     0 / 0  
@Vmarkina, seran los mas tristes pero no te quejes que mucha jente mataria por una principal xD

Vmarkina
Vmarkina    
     0 / 0  
@chemachantada, Me da igual, que se maten, yo ésta no la quería :S

chemachantada
chemachantada    
     0 / 0  
@Vmarkina, pues no la subieras xD

Vmarkina
Vmarkina    
     0 / 0  
@chemachantada, Qué tendrá que ver una cosa con la otra...

chemachantada
chemachantada    
     0 / 0  
@Vmarkina, mmm tambien tienes razon xD

ajdf
ajdf    
     +2 / 0  
Las palabras más duras que he oido en toda mi vida es cuando me dijieron que había muerto mi abuelo. +1 y fav

Vmarkina
Vmarkina    
     0 / 0  
@ajdf, Más duras palabras...gracias!

Haiass
Haiass    
     +3 / 0  
A mi me las dijo mi madre. No hizo falta que acabara la frase, porque en cuanto dijo "sabes que tu abuelo llevaba un tiempo enfermo..." ya me puse a llorar.
Felicidades por la principal, positivo y a favoritos :)

Vmarkina
Vmarkina    
     +1 / 0  
@Haiass, Gracias :)

LucasSiete
LucasSiete    
     0 / 0  
muy buena :) +1 y Fav

Vmarkina
Vmarkina    
     0 / 0  
@LucasSiete, Gracias

Dan_B
Dan_B    
     +3 / 0  
Realmente llore al leer este cartel, recorde en un segundo las palabras mas duras que me han dicho y podran decir... "Lo siento, a tu papá le queda menos de una semana de vida".

Chukitazo
Chukitazo    
     +8 / 0  
No sé porque asociáis esto al amor, a mi la pérdida de una persona importante me afecta muchísimo más que la de una persona que tiene el más mínimo interés en ti. Dicha noticia me llegó hace unos 23 días "Christian, ya abuela ya ha muerto". El impacto es impresionante y porque no hablar del torbellino de emociones posterior. Pasas día a día pensando en esa persona, en saber que no vas a sentir su piel, no vas a ver su sonrisa... Así que para mí es totalmente incomparable el dolor que se sufre con el amor y el dolor que se sufre con la muerte, porque este ultimo te desgarra el alma...

Lerelerele
Lerelerele    
     +2 / 0  
@Chukitazo, Te entiendo, lo siento por lo de tu abuela :S, en mi caso era mi perro, que aunque no de sangre, era uno más de la familia, cuando me dijeron que tenia cáncer y no se le podia hacer nada para salvarle, cuando me dieron a elegir dia para sacrificarle... el mundo se me calló al suelo, no poder volver a sentir sus lametazos en mi cara, sus ojos mirarme...Me quería morir..PORFAVOR no lo compareis con no poder estar con la persona que amas, porque aunque no tengas relación con ella, no es comparable con perder algo muy importante para siempre, con la muerte.

Vmarkina
Vmarkina    
     0 / 0  
@Chukitazo, Pues a mí el amor me ha hecho más daño que la muerte de mis abuelos. Cada uno es como es, y se toma las cosas como se las toma, no debes generalizar y decir que tal es más grave que lo otro o viceversa. Habla de ti y de nadie más.

InnerCia
InnerCia    
     +1 / 0  
Las palabras más duras fueron cuando la persona que amaba me mandó a la mierda.....

LauritaDH
LauritaDH    
     +1 / 0  
Las palabras mas duras que he escuchado y espero escuchar fueron: "Tu primo tiene cáncer" y un año más tarde "Tu padre tiene cáncer"

flexoamarillo
flexoamarillo    
     +1 / 0  
Las palabras mas duras que he ecuchado han sido, Irene, como que irene? Irene a muerto esta tarde, era una de mis mejores amigas y tenia 16 años...

InnerCia
InnerCia    
     +4 / 0  
A todos los que habéis perdido a alguien o pasáis una situación similar, mucho ánimo....me ha hecho darme cuenta de que mi problema en comparación no es nada, os deseo mucha suerte y ánimo.

laura_isla
laura_isla    
     0 / 0  
@InnerCia, Gran comentario el tuyo ;)

InnerCia
InnerCia    
     +1 / 0  
@laura_isla, Grande no....como muchos, lo leí y pensé en eso, una persona querida y amada como una paeja.... pero nunca he vivido la muerte de un pariente cercano (bueno, abuelos, pero no los conocí...) y cosas así....así que después de leer los comentarios del resto, me di cuentas que lo mío no llega ni a la categoría de problemilla.

Sugar94
Sugar94    
     +3 / 0  
Yo no necesite escuchar palabras,los gritos de mi madre me bastaron. Me acerque a la ventana y vi la ambulancia en la puerta y luego ya no volví a ver a mi padre...

loveee (L)
loveee (L)    
     0 / 0  
@Sugar94, eso si que tubo que ser dificil :(

Vmarkina
Vmarkina    
     +7 / 0  
No pretendía que esto fuera una reunión de desmotivad0s deprimidos anónimos o algo similar. Hice este cartel porque me pareció algo que hemos sufrido todos, y lo reflejé de esta manera, pero joder, todo pasa y la vida sigue, y las lágrimas se convierten en sonrisas, y los fracasos en sueños, hay que mirar hacia adelante a pesar de todo lo que nos dejamos en el camino!

carla_love
carla_love    
     +1 / 0  
Me ha recordado a cuando me dieron hace como un año lo peor que podía escuchar...Lloré,lloré muchísimo.No podía con mi alma y pensé que jamás sería capaz de superarlo.Estuve varios días destrozada,sin querer ver a nadie.No me he sentido tan mal nunca...Aun así,lo superé.No tardé demasiado,todavía estoy sorprendida por ello.Lo que quería decir,si alguien lee este comentario,es que todo se supera.Que sólo hace falta mirarlo desde otro punto de vista,recordar lo bueno y centrarte en la vida.A todos nos queda mucha vida por delante y mucho por sufrir,pero también muchas razones para sonreír.

desmotivado 15
desmotivado 15    
     +2 / 0  
Lastima, pero igual, mejor hay que aprender a reir

Vmarkina
Vmarkina    
     0 / 0  
@desmotivado 15, Uno no aprende a una cosa u otra, lo hace irremediablemente.

jorgedelossantos
jorgedelossantos    
     0 / 0  
al escuchar que te disen tu primer no te quiero solo juge con tus sentimientos esas son unas de las palabras mas duras para mi.

Vmarkina
Vmarkina    
     0 / 0  
@jorgedelossantos, Las palabras son duras no de forma universal, sino dependiendo del momento, de como te den según el momento...de muchas circunstancias depende.

Quequemelasopa
Quequemelasopa    
     0 / 0  
Este cartel también puede referirse a cuando...tienen que decirte que ha muerto un ser querido, no sé.
PD: Buen cartel.

Vmarkina
Vmarkina    
     0 / 0  
@Quequemelasopa, Sí, también puede referirse a eso.
Gracias!

SilviaGarciaChip
SilviaGarciaChip    
     +1 / 0  
si algo te duele, recuerda: nada es para siempre
muy buen cartel

Vmarkina
Vmarkina    
     0 / 0  
@SilviaGarciaChip, Yo pienso igual, todo pasa :)
Gracias!!

Payasete90
Payasete90    
     +1 / 0  
Me llamo EARL

Lawliet16
Lawliet16    
     0 / 0  
@Payasete90, eso es una serie e.e

Nathuxa...!!
Nathuxa...!!    
     +4 / 0  
image
Es Increiblee.....
Como alguien puede romper tu corazon sin
embargo siges amandole
con cada uno de los pedacitos... -_-


Vmarkina
Vmarkina    
     +4 / 0  
@Nathuxa...!!, Bueno, así de estúpidos somos los seres humanos, dándonos de bruces constantemente con nuestros propios errores continuamente.

Lawliet16
Lawliet16    
     0 / 0  
@Vmarkina, tienes mucha razon

Vmarkina
Vmarkina    
     0 / 0  
@Lawliet16, Gracias^^

Lawliet16
Lawliet16    
     0 / 0  
@Vmarkina, no las des hombreo o mujer xDD

Vmarkina
Vmarkina    
     0 / 0  
@Lawliet16, Es de buen nacido ser agradecido^^

Lawliet16
Lawliet16    
     0 / 0  
@Vmarkina, jaja por lo que veo te gusta detective conan?

Vmarkina
Vmarkina    
     0 / 0  
@Lawliet16, ¿Qué si me gusta? Soy el detective de la página jojojo
Adoro esa serie :)

Lerstons
Lerstons    
     0 / 0  
@Vmarkina, Pues yo soy Gin jajajajajaja

Vmarkina
Vmarkina    
     +1 / 0  
@Lerstons, jajajajajajaja
No eres Gin! Tú eres demasiado buen chico xD

Lerstons
Lerstons    
     0 / 0  
@Vmarkina, Cogoro? xDDDDDDD

Vmarkina
Vmarkina    
     +1 / 0  
@Lerstons, Kogoro* en todo caso xD
Y ná, salvo que seas muy tonto y torpe...xD

Lerstons
Lerstons    
     0 / 0  
@Vmarkina, Tonto sí, torpe no tanto jajajajaja

Vmarkina
Vmarkina    
     0 / 0  
@Lerstons, jejejeje

Lawliet16
Lawliet16    
     0 / 0  
@Vmarkina, vale xDD

miguel352
miguel352    
     0 / 0  
@Nathuxa...!!, es muy cierto

Lawliet16
Lawliet16    
     0 / 0  
@miguel352, :3

desmotivado 15
desmotivado 15    
     0 / 0  
@Lawliet16, 3 años tardaste en responder, pero lo valió

alex23
alex23    
     0 / 0  
desmotivado 15
desmotivado 15    
     0 / 0  
@alex23, y tú 12 días, todo el mundo es lento!

alex23
alex23    
     0 / 0  
@desmotivado 15, Porque hacia cosa de un mes o más que no entraba xD pero 3 años ya es otro nivel xD

desmotivado 15
desmotivado 15    
     0 / 0  
@alex23, Y sólo por una carita e.e

Lerstons
Lerstons    
     0 / 0  
Mi padre: Vete de aquí, no quiero volver a verte en esta casa.

Vmarkina
Vmarkina    
     0 / 0  
@Lerstons, :(

miguel352
miguel352    
     0 / 0  
para resumir el cuento. digamos que en menos de un mes me entere de 6 noticias fulminantes, cada una de ellas mato uno de mis sueños,y cada una fue peor que la anterios no podia hacer nada para cambiarlo y a la unica persona a la que le pedi qu creyera en mi no lo hizo. lo mas doloroso de todo fue no poder mostrar mi llanto, y tener que llorar para adentro todos los dias por no poder contarle a nadie lo que me pasaba

Maria_SastraDeSonriisas
Maria_SastraDeSonriisas    
     +1 / 0  
No me hagas recordarlo que lloro...si ya estoy llorando! Le quiero, coño!

karlyesparzah
karlyesparzah    
     0 / 0  
cuando decepcionas atus padres:c

mimii
mimii    
     0 / 0  
Pues si..TT

Cami-Rocker
Cami-Rocker    
     +1 / 0  
"Quiero terminar, te engañé con ella y la quiero a ella" si habré llorado...Hasta hoy lo hago u_u

f10
f10    
     0 / 0  
image
No esperes que te olvide
No esperes que te olvide, ni
olvides que te espero
-Vmarkina


f10
f10    
     0 / 0  
@f10, que mal sale
debi poner tacatacatacatacataca

adrysmaug
adrysmaug    
     +1 / 0  
pagina 2340 de la principal D:

TuPadre666
TuPadre666    
     0 / 0  
@adrysmaug, En serio? Qué se te ha perdido por ahí? jajajajaja

adrysmaug
adrysmaug    
     0 / 0  
@TuPadre666, V?
por lo menos su avatar tienes D:

TuPadre666
TuPadre666    
     0 / 0  
@adrysmaug, El mismo jeme

adrysmaug
adrysmaug    
     0 / 0  
@TuPadre666, V :3
techaba de menos D:

TuPadre666
TuPadre666    
     0 / 0  
@adrysmaug, Lo dudo severamente jeje esto es un desierto

adrysmaug
adrysmaug    
     0 / 0  
@TuPadre666, si la verdad es que da algo de penita
pero ultimamente resurgen veteranos jajaja

TuPadre666
TuPadre666    
     0 / 0  
@adrysmaug, Lo mío son coletazos pero no volver xD

sm89
sm89    
     0 / 0  
@TuPadre666, V guapo

f10
f10    
     0 / 0  
@sm89, es mio pipiola!

sm89
sm89    
     0 / 0  
@f10, estás que sí



Iniciar sesión, para comentar tienes que registrarte.


LOS MEJORES CARTELES DE

Número de visitas: 10260253717 | Usuarios registrados: 2024289 | Clasificación de usuarios
Carteles en la página: 7937604, hoy: 100, ayer: 93
blog.desmotivaciones.es
Contacto | Reglas
▲▲▲

Valid HTML 5 Valid CSS!